View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_162 (Length: 231)
Name: NF1773_low_162
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_162 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 15169400 - 15169172
Alignment:
| Q |
1 |
acaaactcgacatatcttcgatgaagatttattggcaggaggaggcttatgctgcaaaaacaacaaaaatatagcatacaatacatgtaagaccaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15169400 |
acaaactcgacatatcttcgatgaagatttattggcaggaggaggcttatgctgcaaaaacaacaaaaatatagcatacaatacatgtaagaccaatgct |
15169301 |
T |
|
| Q |
101 |
ttatnnnnnnnnnncttgaaatcgaaccgacaagacattctgatcatggttcaactgctttaaactttccgaaccaaaacgaaagaaggaaaaggtaaat |
200 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
15169300 |
ttat--aaaacaaacttgaaatggaaccgacaagacattctcatcatggttcaactgctttaaactgtccaaaccaaaatgaaagaaggaaaaggtaaat |
15169203 |
T |
|
| Q |
201 |
acctcatcagagtcatgtgagaaatgagaat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15169202 |
acctcatcagagtcatgtgagaaatgagaat |
15169172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University