View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_169 (Length: 226)

Name: NF1773_low_169
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_169
NF1773_low_169
[»] chr2 (1 HSPs)
chr2 (1-220)||(6284660-6284875)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 6284875 - 6284660
Alignment:
1 tcttccactaaaagattatttggattagacaatcttcctaacaaaaagttacatgtctccttgagtgattgcaataaggttgattgtatgtggttgtaga 100  Q
    ||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6284875 tcttccattaaaaatttatttggattagacaatcttcctaacaaaaagttacatgtctccttgagtgattgcaataaggttgattgtatgtggttgtaga 6284776  T
101 ttatctcaatccatttactactattccatgcaaataaaaggatacagtaaactaatagagacatatannnnnnnngtttgaaagataatagagacatata 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||        ||||||||||||||||||||    |    
6284775 ttatctcaatccatttactactattccatgcaaataaaatgatacagtaaactaatagagacatatattttttttgtttgaaagataatagagac----a 6284680  T
201 taataattaagactcaaaca 220  Q
    ||||||||||||||||||||    
6284679 taataattaagactcaaaca 6284660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University