View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_176 (Length: 215)
Name: NF1773_low_176
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_176 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 35984 - 36168
Alignment:
| Q |
18 |
gtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggttgtggttattggtgttggtgtttgtaccgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35984 |
gtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggttgtggttattggtgttggtgtttgtaccgtaa |
36083 |
T |
 |
| Q |
118 |
ctgatgtaaaagttaacctcacaggtttcacatgtgcatgtttagcagttttctctacatctttgcaacaaattgtaagtattat |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084 |
ctgatgtaaaagttaacctcaaaggtttcacatgtgcatgtttagcagttttctctacatctttgcaacaaattgtaagtattat |
36168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 8676665 - 8676538
Alignment:
| Q |
18 |
gtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggttgtggttattggtgttggtgtttgtaccgtaa |
117 |
Q |
| |
|
|||||||| |||||| |||| ||||||| ||| |||| |||||| |||||||| | || || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8676665 |
gtttgtgtgatggaatggatccttcacagcaaacactactcaagggaagtgaaagtgtcggtcatggttgtggttattggtgttggtgtttgcaccgtaa |
8676566 |
T |
 |
| Q |
118 |
ctgatgtaaaagttaacctcacaggttt |
145 |
Q |
| |
|
|||||||||| |||||| ||| |||||| |
|
|
| T |
8676565 |
ctgatgtaaatgttaacttcaaaggttt |
8676538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University