View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_177 (Length: 214)

Name: NF1773_low_177
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_177
NF1773_low_177
[»] chr5 (1 HSPs)
chr5 (14-165)||(43175315-43175466)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 43175466 - 43175315
Alignment:
14 ataattctgtattctactctattcaatgcatcttcatctaccactcatgatagcattgaacatgtcgtcaacaacgatggcggtggtcagtggttagaat 113  Q
    |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43175466 ataattctgtattctactctattcaatgcatcttcaacaaccactcatgatagcattgaacatgtcgtcaacaacgatggcggtggtcagtggttagaat 43175367  T
114 acaatgcaatagaatcagagaatgattctgaaaatgttacagaaagtgaatc 165  Q
    ||| ||||   ||||| | ||||||| |||||||||||||||||||||||||    
43175366 acattgcatccgaatctgcgaatgatgctgaaaatgttacagaaagtgaatc 43175315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University