View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_65 (Length: 395)
Name: NF1773_low_65
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 5e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 40 - 238
Target Start/End: Complemental strand, 1927519 - 1927327
Alignment:
| Q |
40 |
ttttacaatttcctagcaaggctgttgaccttctacaatcttatgtctaatctaattgattgttcaaatcaacaacaaaattgcatagtcactcgatcct |
139 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927519 |
ttttagaatttcctagcaaggctgttgaccttccacaa----atgtctaatctaattgattgttcaaatcaacaacaaaattgcatagtcactcgatcct |
1927424 |
T |
|
| Q |
140 |
ttatcatatgtgtagattaatctaatgtcctttaaaagtacttaaaataagaagtagtnnnnnnnntaattcaacataaatctagttgcttaacataag |
238 |
Q |
| |
|
|||||| |||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1927423 |
ttatcacatgtgtagattaatctaacgacctttaaaagtacttaaaataagaagtagt--aaaaaataattcaacataaatctagttgcttaacataag |
1927327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 336 - 395
Target Start/End: Complemental strand, 1927229 - 1927170
Alignment:
| Q |
336 |
tctcacttaaacttttttatgtgagtatgtgtgccaagcataattgatttgtggctcaca |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1927229 |
tctcacttaaacttttttatgtgagtatgtgtgccaagcataattgatttgttgctcaca |
1927170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University