View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_85 (Length: 355)
Name: NF1773_low_85
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_85 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 16530318 - 16530102
Alignment:
| Q |
18 |
tttggatggttatttatttt-ctttcttatgatgtagcctttgtttttgtatcccggtgcttatagtaccaagtttttgtctccctttaattaattaatt |
116 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16530318 |
tttggatcgttatttgtttttctttcttatgatgtaacctttgtttttgtatcccggtgcttatagtaccaagtttttgtctccctttaattaattaatt |
16530219 |
T |
 |
| Q |
117 |
gtacttgtaaaataaaggaaaatatttcatatacattcaatatttattctacaatttgagagagaaaggaacagaattggtgatctaatagacgtgatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16530218 |
gtacttgtaaaataaaggaaaatatttcctatacatccaatatttattctacaatttgagagagaaaggaacagaattggtgatctaatagacgtgatat |
16530119 |
T |
 |
| Q |
217 |
gtttgtgtaagctcaat |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16530118 |
gtttgtgtaagctcaat |
16530102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 230 - 295
Target Start/End: Complemental strand, 16530167 - 16530102
Alignment:
| Q |
230 |
caatttgagagagaaaggaacacaattagtgatctaatagacgtgataagtttgtgtaagctcaat |
295 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16530167 |
caatttgagagagaaaggaacagaattggtgatctaatagacgtgatatgtttgtgtaagctcaat |
16530102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 300 - 344
Target Start/End: Complemental strand, 16530077 - 16530033
Alignment:
| Q |
300 |
ggaacaatatctacttttagaggagaatcctcgaacatgatgatg |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16530077 |
ggaacaatatctacttttagaggagaatcctcgaacatgatgatg |
16530033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University