View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17740_low_9 (Length: 253)
Name: NF17740_low_9
Description: NF17740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17740_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 38859329 - 38859102
Alignment:
| Q |
19 |
tggatgagagtatttcatactccaaatccacattaaaagtgtagtcatctcgttcaacaagtaggaaaaaggatcttcaagagcgttcttcaaacttcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38859329 |
tggatgagagtatttcatactccaaatccacat-------gtagtcatctcgttcaacaagtaggaaaaaggatcttcaagagtgttcttcaaacttcaa |
38859237 |
T |
 |
| Q |
119 |
agcttgcttaaatgtcttcaaatttgatgcgacaatattcatcggaatcggatcgcaagttttttcctggtttgcatcaaaatcttcatcatcattatgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38859236 |
agcttgcttaaatgtcttcaaatttgatgcgacaatattcatcggaaccggatcgcaagttttttcctggtttgcatcaaaatcttcatcatcattatgt |
38859137 |
T |
 |
| Q |
219 |
aattgagtggcatcatcaaatttatattcatcatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38859136 |
aattgagtggcatcatcaaatttatattcatcatt |
38859102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University