View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17741_low_9 (Length: 265)
Name: NF17741_low_9
Description: NF17741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17741_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 48 - 261
Target Start/End: Complemental strand, 52872847 - 52872634
Alignment:
| Q |
48 |
caagtaagaattaccaattgcgtttcgtgattgcatgcggcgttgttgtcatcggcatttgttgttgtgaacatgaagaaggagagaataagaatgtttg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52872847 |
caagtaagaattaccaattgcgtttcgtgattgcatgcggcgttgttgtcatcggcatttgttgttgggaacatgaagaaggagagaataagaatgtttg |
52872748 |
T |
|
| Q |
148 |
ccaccaagtgcgaaaaccaccgcattattattgttaattcaattcaatttgctagagagagaaaatgatatattaaactttgtttgcgtttggattcctt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52872747 |
ccaccaagtgcgaaaaccaccgcattattattattaattcaattcaatttgctagagagagaaaatgatatattaaactgtgtttgcgtttggattcctt |
52872648 |
T |
|
| Q |
248 |
ttccctctctccct |
261 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52872647 |
ttccctctctccct |
52872634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University