View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_high_13 (Length: 419)
Name: NF17742_high_13
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 19 - 160
Target Start/End: Complemental strand, 41705600 - 41705459
Alignment:
| Q |
19 |
ggtagggggagagggatccgaggtaagcttgggttttaattcacagaggatgcagttgaacggtgtgcatgggaaccaaacaaggtcacttcctgtgtcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705600 |
ggtagggggagagggatccgaggtaagcttgggttttaattcacagaggatgcagttgaacggtgtgcatgggaaccaaacaaggtcacttcctgtgtcc |
41705501 |
T |
 |
| Q |
119 |
atgtagagagttatgggttgggagtggggtccgaggttgaag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705500 |
atgtagagagttatgggttgggagtggggtccgaggttgaag |
41705459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 320 - 405
Target Start/End: Complemental strand, 41705299 - 41705214
Alignment:
| Q |
320 |
aatagtagcatttgagaggaagaatgtgaaatgaagagggtgatgatgaggaggaataacaggggagggggcatttggtttaacag |
405 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||| |||||| ||||||||||||| | ||||||||| ||||| |
|
|
| T |
41705299 |
aatagtagcatttgagatgaagaatgtgaaatgaagagtgtgatgaggaggagaaataacaggggagaagccatttggttaaacag |
41705214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 58 - 138
Target Start/End: Original strand, 3744338 - 3744418
Alignment:
| Q |
58 |
ttcacagaggatgcagttgaacggtgtgcatgggaaccaaacaaggtcacttcctgtgtccatgtagagagttatgggttg |
138 |
Q |
| |
|
||||||||| ||||| | ||| |||| || ||||||||||||||||| || ||||||||||||||||| |||||| |||| |
|
|
| T |
3744338 |
ttcacagagaatgcattcgaaaggtgaacaagggaaccaaacaaggtcgctacctgtgtccatgtagagtgttatgagttg |
3744418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University