View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_high_19 (Length: 389)
Name: NF17742_high_19
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 7 - 382
Target Start/End: Complemental strand, 14419013 - 14418638
Alignment:
| Q |
7 |
gtttcttctttcttactccatttgtatactattccaataatgtctggggtttgggttttcaagaacggcgtggtgcggctagtggatggcgcggaggcga |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14419013 |
gtttcttctttcttgctccatttgtatactattccaataatgtctggggtttgggttttcaagaacggcgtggtgcggctagtggatggcgtggaggcga |
14418914 |
T |
|
| Q |
107 |
tggagggtggccgccaagggtcaggcggacggcgaaaagtgttggttcataccgcaagcaacgagattatcacctcttatgccgttttagagcgcaagct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14418913 |
tggagggtggccgccaagggtcaggcggacggcgcaaggtgttggttcataccgcaagcaacgagattatcacctcttatgccgttttagagcgcaagct |
14418814 |
T |
|
| Q |
207 |
aagttcattggggtgggagcgttactatgatgaccctgacctcctccagttccacaaacgctcaaccgttcatcttatctcccttcccatggatttcaac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14418813 |
aagttcattggggtgggagcgttactatgatgaccctgacctcctccagttccacaaacgctcaaccgttcatcttatctcccttcctatggatttcaac |
14418714 |
T |
|
| Q |
307 |
aggttcaagtccatgcacatgtatgacatcgttgtcaagaacaagaactcctttgaagttagggaaatgatgatgt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14418713 |
aggttcaagtccatgcacatgtatgacatcgttgtcaagaacaagaactcctttgaagttagggaaatgatgatgt |
14418638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 355
Target Start/End: Original strand, 49633923 - 49633977
Alignment:
| Q |
301 |
ttcaacaggttcaagtccatgcacatgtatgacatcgttgtcaagaacaagaact |
355 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
49633923 |
ttcaacaagctcaagcccatgcacatgtatgacattgtcgtcaagaacaagaact |
49633977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University