View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_high_32 (Length: 251)
Name: NF17742_high_32
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 35991036 - 35991277
Alignment:
| Q |
1 |
cctttgcgataaaaacaaaccttgcaatttagtgcattttcttgcttttattgtaatggaatctactgtttattagggatccagtgctaataaaaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991036 |
cctttgcgataaaaacaaaccttgcaatttagtgcattttcttgcttttattgtaatggaatctactgtttattagggatccagtgctaataaaaaagat |
35991135 |
T |
|
| Q |
101 |
tggagaagcaactgcccttgaagttagagctactggaattccatacgtgtttgctccatgtatcgcggtaaagaaacagtgtttcaatattctgttattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991136 |
tggagaagcaactgcccttgaagttagagctactggaattccatatgtgtttgctccatgtatcgcggtaaagaaacagtgtttcaatattctgttattt |
35991235 |
T |
|
| Q |
201 |
aaatcatatgtaacattgatcaagtttgctgatatgatgatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35991236 |
aaatcatatgtaacattgatcaagtttgctgatatgttgatg |
35991277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 145
Target Start/End: Original strand, 9990262 - 9990311
Alignment:
| Q |
96 |
aagattggagaagcaactgcccttgaagttagagctactggaattccata |
145 |
Q |
| |
|
|||||||| || |||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
9990262 |
aagattggtgatgcaactgctcttgaagctagagcaactggaattccata |
9990311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 171
Target Start/End: Original strand, 10011817 - 10011889
Alignment:
| Q |
99 |
attggagaagcaactgcccttgaagttagagctactggaattccatacgtgtttgctccatgtatcgcggtaa |
171 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||| || ||||||||||| || || || || || |||||||||| |
|
|
| T |
10011817 |
attggtgaagcaactgctcttgaagctagagcaacgggaattccatatgtcttcgcgccttgcatcgcggtaa |
10011889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University