View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_38 (Length: 334)
Name: NF17742_low_38
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_38 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 172 - 334
Target Start/End: Original strand, 14542485 - 14542647
Alignment:
| Q |
172 |
ctcagtgcatgttcatataatattcctggtccacaatggtggtacgtaaccagccacttgcaaatggacaaatatcttatagccaccaaaataacaccat |
271 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14542485 |
ctcagtgcatgttcatataatatttctggtccacaatggtggtacgtaaccagccacttgcaaatggacaaatatcttatagccaccaaaataacaccat |
14542584 |
T |
|
| Q |
272 |
aaacatttttactaatagatttcagaaattgagtccnnnnnnntagtagattttaaattgtct |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14542585 |
aaacatttttactaatagatttcagaaattgagtccaaaaaaatagtagattttaaattgtct |
14542647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 14542314 - 14542393
Alignment:
| Q |
1 |
aaatgtgatgcatagaaaagtgaaagaaaacattttatttttcaggaaagagagaaaggaaacatagaactgataataat |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14542314 |
aaatgtgatgcatagaaaagtgaaaggaaacattttatttttcaggaaagagagaaaggaaacatagaactgataataat |
14542393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University