View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_42 (Length: 313)
Name: NF17742_low_42
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 293
Target Start/End: Complemental strand, 26495552 - 26495271
Alignment:
| Q |
12 |
catcatcatcggaaaggcacggtggtgcgcgttccggcaaagattgtgccatggaagagtggtggtgctgttggtgtggtttccatgaaggtgttggatc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26495552 |
catcatcatcggaaaggcacggtggtgcgcgttccggcaaagattgtgccatggaagagtggtggtggtgttggtgtggtttccatgaaggtgttggatc |
26495453 |
T |
|
| Q |
112 |
ctatgatgaggagggaattggctataaggagagttttggaggatggtgatgagaaatgtttgagggagtattggctttttggaaccaaaaggggtgatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495452 |
ctatgatgaggagggaattggctataaggagagttttggaggatggtgatgagaaatgtttgagggagtattggctttttggaaccaaaaggggtgatat |
26495353 |
T |
|
| Q |
212 |
aattttcacacaatgttggactcctctttctgttaagattaggtatgtttataggtttggattcttcaataatcatagtttt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495352 |
aattttcacacaatgttggactcctctttctgttaagattaggtatgtttataggtttggattcttcaataatcatagtttt |
26495271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University