View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_47 (Length: 299)
Name: NF17742_low_47
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 441423 - 441244
Alignment:
| Q |
18 |
ggagtgtgacaagcaagaatatggtaactttgatctctttatgtgtattattttaatccgattgatatataatgtgaatgatggttatttaagttaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
441423 |
ggagtgtgacaagcaagaatatggtaactttgatctctttatgtgtattattttaatccgattgatatataatgtgaatgatggttatttaagttaattg |
441324 |
T |
 |
| Q |
118 |
tgaaatattatgcagttttaagtggaaggaaaatgaccttagagccacttcatggtggaaagtgtaaaggaaagggaggc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
441323 |
tgaaatattatgcagttttaagtggaaggaaaatgaccttagagccacttcatggtggaaagtgtaaaggaaagggaggc |
441244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 453687 - 453601
Alignment:
| Q |
92 |
tgaatgatggttatttaagttaattgtgaaatattatgcagttttaagtggaaggaaaatgaccttagagccacttcatggtggaaa |
178 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||| |||||||||||||| ||| || ||||||||| |||||||||| |
|
|
| T |
453687 |
tgaatgatagttatttaagtcaattgtgcaatattatgcagttataagtggaaggaaattgattttggagccacttaatggtggaaa |
453601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University