View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_52 (Length: 277)
Name: NF17742_low_52
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_52 |
 | |
|
| [»] scaffold0903 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 62 - 268
Target Start/End: Original strand, 21716884 - 21717090
Alignment:
| Q |
62 |
ccaatcattgcacgaagatgtcaagcagtagagagtattcgaatagcagaggatctcactcattttcaatttctggaaacggtggatcgcgcaatattgg |
161 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
21716884 |
ccaatcattgcgcgaagatgtcaagcagtagagggtattcgaatagcagaggatctcactcattttcaatttccagaaacggtggatcgtgcaatattgg |
21716983 |
T |
|
| Q |
162 |
tggtggattccgcagcattggccgtaacccaaacagcggtggtcgtaaccccaagcagatgatgtctatgttacctgtttgtggctgtaacctccctatg |
261 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21716984 |
tggtggatcccgcagcagtggccgtaacccaaacagcggtggtcgtaaccccaagcagatgatgtctatgttacctgtttgtggttgtaacctccctatg |
21717083 |
T |
|
| Q |
262 |
atgatgt |
268 |
Q |
| |
|
| ||||| |
|
|
| T |
21717084 |
aggatgt |
21717090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 106 - 215
Target Start/End: Complemental strand, 20656754 - 20656645
Alignment:
| Q |
106 |
agcagaggatctcactcattttcaatttctggaaacggtggatcgcgcaatattggtggtggattccgcagcattggccgtaacccaaacagcggtggtc |
205 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||||||||||| ||||| | ||||||| ||| |||| | ||| |||||| |||||| ||||||| |
|
|
| T |
20656754 |
agcagaggttctcactcattttcaatctctagaaacggtggatcccgcaagagtggtggtagatctcgcaacggtggtcgtaacgcaaacaatggtggtc |
20656655 |
T |
|
| Q |
206 |
gtaaccccaa |
215 |
Q |
| |
|
||||| |||| |
|
|
| T |
20656654 |
gtaacaccaa |
20656645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 199 - 268
Target Start/End: Complemental strand, 20656640 - 20656571
Alignment:
| Q |
199 |
ggtggtcgtaaccccaagcagatgatgtctatgttacctgtttgtggctgtaacctccctatgatgatgt |
268 |
Q |
| |
|
|||||||||||||| || |||||||||| || | ||||| ||||||| ||||| |||||||||| ||||| |
|
|
| T |
20656640 |
ggtggtcgtaacccgaaccagatgatgtgtacgctacctatttgtggttgtaaactccctatgaggatgt |
20656571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0903 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0903
Description:
Target: scaffold0903; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 62 - 268
Target Start/End: Original strand, 467 - 673
Alignment:
| Q |
62 |
ccaatcattgcacgaagatgtcaagcagtagagagtattcgaatagcagaggatctcactcattttcaatttctggaaacggtggatcgcgcaatattgg |
161 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
467 |
ccaatcattgcgcgatgatgtcaagcaatagagggtattcgaatagcagaggatctcactcattttcaatttccagaaacggtggatcgcgcaatattgg |
566 |
T |
|
| Q |
162 |
tggtggattccgcagcattggccgtaacccaaacagcggtggtcgtaaccccaagcagatgatgtctatgttacctgtttgtggctgtaacctccctatg |
261 |
Q |
| |
|
| || ||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
567 |
tcgtaacccaaatagcggtggtcgtaacccaaacagcggtggtcgtaaccccaagcagatgatatctatgttacttgtttgtggatgtaacctccctatg |
666 |
T |
|
| Q |
262 |
atgatgt |
268 |
Q |
| |
|
| ||||| |
|
|
| T |
667 |
aggatgt |
673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University