View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_53 (Length: 272)
Name: NF17742_low_53
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 40405651 - 40405396
Alignment:
| Q |
1 |
agcacccttcttgcattttacaatattatatgaaattgaaagtttaggttaagannnnnnnnnnnnnnnnnnnnnnnnncccggtcatggatcccatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40405651 |
agcacccttcttgcattttacaatattatatgaaattgatagtttaggttaagattttttctttttcaatttttattttcccggtcatggatcccatgtt |
40405552 |
T |
 |
| Q |
101 |
aaaatcagactttgctaccagcacctccacctgcacgattggaatcggttccaatcttcacaacatcaattatatgaccaccactcaactcttgaccctt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405551 |
aaaatcagactttgctaccggcacctccacctgcacgattgggatctgttccaatcttcacaacatcaattatatgaccaccactcaactcttgaccctt |
40405452 |
T |
 |
| Q |
201 |
cattggtgcctctaccactggtgtagcatttctatatatcaaatacaccaccatct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405451 |
cattggtgcctctaccactggtgtagcatttctatatatcaaatacaccaccatct |
40405396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University