View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_54 (Length: 261)
Name: NF17742_low_54
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 3612923 - 3613169
Alignment:
| Q |
9 |
ttgcacttgcactagtcttccagcaaatcctccaaaagtgataaagccaaaaacaaataatattttccttttttaccctcctttttatcgatacaatggc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3612923 |
ttgcacttgcactagtcttccatcaaatcctccaaaagtgataaagccaaaaacaaataatattttccttttttaccctcctttttatcgatacaatggc |
3613022 |
T |
|
| Q |
109 |
caatactaagcatgaatctgcaaattttcttgaccaaatattagctactgatgaggcacgacatgtatatgcattagcaaaagagcgccaggctgctcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3613023 |
caatactaagcatgaatctgcaaattttcttgaccaaatactagctactgatgaggcacgacatgtatatgcatttgcaaaagagcgccaggctgctcaa |
3613122 |
T |
|
| Q |
209 |
gttgggattgctaacaatgttatctctgctgatttgtgtgatgatgt |
255 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3613123 |
gttgggattgctaacaatggtatctctgctgatttgtgtgatgatgt |
3613169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 14756973 - 14757037
Alignment:
| Q |
15 |
ttgcactagtcttccagcaaatcctccaaaagtgataaagccaaaaacaaataatattttccttt |
79 |
Q |
| |
|
|||||| ||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14756973 |
ttgcaccagtcttccatccaatcctccaaaagtgataaagccaaaaacaaattatattttccttt |
14757037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University