View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_56 (Length: 256)
Name: NF17742_low_56
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 11 - 123
Target Start/End: Complemental strand, 8931724 - 8931612
Alignment:
| Q |
11 |
tttaagttgtgttgcatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagtaccttagtgctgaatcgctttctcatctcaaaagc |
110 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931724 |
tttaagttgtcttgtatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagtaccttagtgctgaatcgctttctcatctcaaaagc |
8931625 |
T |
 |
| Q |
111 |
tggcgtgccatcc |
123 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8931624 |
tggcgtgccatcc |
8931612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 8931526 - 8931479
Alignment:
| Q |
209 |
ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931526 |
ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatga |
8931479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University