View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_63 (Length: 238)
Name: NF17742_low_63
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 15871962 - 15871744
Alignment:
| Q |
4 |
cagaggctagttaagacaaacgtcaaagctcaaaagaggcacttaattaaagattactttcttacgctctttttctaagnnnnnnnnngtttttgcgagt |
103 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||| ||||||||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
15871962 |
cagaggctagctaagacaaacatcaaagctcaaaagaggtacttgattaaagattactttcttatgctctttttttaagaaaaaaa--gtttttgcgagt |
15871865 |
T |
 |
| Q |
104 |
ttggtcctggaggttcatctaggcaggcataaaaactcagaataaggattcatagattacctacaaattatatccttacgcgggaagcgatgatgaatcc |
203 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15871864 |
ttggtcctggaggctcatcg-gacaggcataaaaactcagaataaacattcatagattacctacaaattatatccttacgcgggaagcgatgatgaatcc |
15871766 |
T |
 |
| Q |
204 |
atgaccatgtaaggtatgaatc |
225 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
15871765 |
atgaccatgtgaggtatgaatc |
15871744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University