View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_68 (Length: 236)
Name: NF17742_low_68
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_68 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 15084030 - 15083798
Alignment:
| Q |
1 |
accttgttgtgttgctgtcccatttcacagcgcctgagccgtcgacaagacggagattcccgttggtttgaaactgaaaggagcccccggagtcaactgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15084030 |
accttgttgtgttgctgtcccatttcacagcgcctgagccgttgacaagacggagattcccgttggtttgaaactgaaaggagcccccggagtcaactgc |
15083931 |
T |
|
| Q |
101 |
ggtggagtttccagctgtccagacaactggagctccaccggagtagactactgcggcgaggaaggaaggaggggttgttggtggggtggtttggatgaaa |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15083930 |
gatggagtttccagctgtccagacaactggagctccaccggagtagactacggcggcgaggaaggaaggaggggttgttggtggggtggtttggatgaaa |
15083831 |
T |
|
| Q |
201 |
cggagggagaaagtggaggatgatgatgtccat |
233 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |
|
|
| T |
15083830 |
cggagggagaaagtggaggatggtgatgaccat |
15083798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 60 - 185
Target Start/End: Complemental strand, 15087794 - 15087669
Alignment:
| Q |
60 |
ccgttggtttgaaactgaaaggagcccccggagtcaactgcggtggagtttccagctgtccagacaactggagctccaccggagtagactactgcggcga |
159 |
Q |
| |
|
|||||||| ||||||| ||||| || | |||||| || ||||||||||| || |||||||||||||| ||||||||||| ||||| || | ||||||| |
|
|
| T |
15087794 |
ccgttggtaagaaactggaaggaaccactggagtcgacagcggtggagttacctgctgtccagacaacaggagctccaccagagtacacaatggcggcga |
15087695 |
T |
|
| Q |
160 |
ggaaggaaggaggggttgttggtggg |
185 |
Q |
| |
|
||||||||||||| | ||||||||| |
|
|
| T |
15087694 |
ggaaggaaggaggagaggttggtggg |
15087669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University