View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17742_low_76 (Length: 214)

Name: NF17742_low_76
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17742_low_76
NF17742_low_76
[»] chr2 (1 HSPs)
chr2 (12-199)||(1702155-1702342)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 1702342 - 1702155
Alignment:
12 agcacagatatccaaagactccaagattaagataattaggagtggaaccaaacagaatttcattaggacatttgtttttaagatgtgttgttgtcatgcg 111  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||    
1702342 agcacagacatccaaagactcgaagattaagataattaggagtggaaccaaacagaatttcatgaggacatttgtttttaagatgtgttgttggcatgcg 1702243  T
112 atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgcgggtgagcgatgtttct 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
1702242 atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgagggtgagcgatgtttct 1702155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University