View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_76 (Length: 214)
Name: NF17742_low_76
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 1702342 - 1702155
Alignment:
| Q |
12 |
agcacagatatccaaagactccaagattaagataattaggagtggaaccaaacagaatttcattaggacatttgtttttaagatgtgttgttgtcatgcg |
111 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1702342 |
agcacagacatccaaagactcgaagattaagataattaggagtggaaccaaacagaatttcatgaggacatttgtttttaagatgtgttgttggcatgcg |
1702243 |
T |
 |
| Q |
112 |
atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgcgggtgagcgatgtttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1702242 |
atttattaaatacaccgccatttggaaggcataacaccagaatttttgtggaacatgagagtgagacatgagggtgagcgatgtttct |
1702155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University