View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17742_low_78 (Length: 213)
Name: NF17742_low_78
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17742_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 54472332 - 54472534
Alignment:
| Q |
9 |
aataggaatttgcaaataagcatgttatgaagtttagaatagttaatggaggaag------------ttaattaattaatgattcatagcctattcttan |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54472332 |
aataggaatttgcaaataagcatgttatgaagtttagaatagttaatgggggaagctaattaattaattaattaattaatgattcatagcctattcttat |
54472431 |
T |
 |
| Q |
97 |
nnnnnngatcagaaatggatcctctaaagcttttgcatggtgccatagtcgacgcggtagaggatccaaatttgaatcttatgtagctacaatatggtgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472432 |
ttttttgatcagaaatggatcctctaaagcttttgcatggtgccatagtcgacgcggtagaggatccaaatttgaatcttatgtagctacaatatggtgt |
54472531 |
T |
 |
| Q |
197 |
tgc |
199 |
Q |
| |
|
||| |
|
|
| T |
54472532 |
tgc |
54472534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University