View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_high_11 (Length: 445)
Name: NF17743_high_11
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 16 - 271
Target Start/End: Complemental strand, 2656617 - 2656362
Alignment:
| Q |
16 |
ctgtgtcgttgtctaaggatttgctaaagacaaaaaggatgacgattgaaaatttgattgaatcatctgaggtggtttatttatgtctcttatatgttaa |
115 |
Q |
| |
|
||||||| |||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656617 |
ctgtgtcattgtctgaggatttcctaaagacgaaaaggatgacgattgaaaatttgattgaatcatctgaggtggtttatttatgtctcttatatgttaa |
2656518 |
T |
 |
| Q |
116 |
taagtttcaatttaaaatagacagttgaacaagtggaccaaataatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656517 |
taagtttcaatttaaaatagacagttgaacaagtggaccaaatgatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgca |
2656418 |
T |
 |
| Q |
216 |
actatatgtgaacctgagaccagtttgaaatggtactttcgttcatgtacctagtg |
271 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
2656417 |
actatatgtgaacctgagaccagtttggaatggtactttcgttcatgtacccagtg |
2656362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University