View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_high_16 (Length: 367)
Name: NF17743_high_16
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 16 - 361
Target Start/End: Complemental strand, 7156628 - 7156283
Alignment:
| Q |
16 |
gtatggctttggatatgatcattccagtgatacttacaaggtggtcgcggtttcttggtatgaatctcttattaatggtaatagggctatgaaaactcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156628 |
gtatggctttggatatgatcattccagtgatacttacaaggtggtcgcagtttcttggtatgaatctcttattaatggtaatagggctatgaaaactcaa |
7156529 |
T |
|
| Q |
116 |
gtaaatgttcacaccatgggtaccgattattggagaaggattcaaacccatttcccttatcgttttcctaataccggaacaggaaatttcgttagtggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156528 |
gtaaatgttcacaccatgggtaccgattattggagaaggattcaaacccatttcccttatcgttttcctaataccggaacaggaaatttcgttagtggaa |
7156429 |
T |
|
| Q |
216 |
cttttaattggtttgaagcagaacatcgttttccttatacacgaagcattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156428 |
cttttaattggtttgaagcagaacatcgttttccttatacacgaagcattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctga |
7156329 |
T |
|
| Q |
316 |
ttatggagggatgtctgtgttttctccaatcttaaatgtgatgatg |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156328 |
ttatggagggatgtctgtgttttctccaatcttaaatgtgatgatg |
7156283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 322
Target Start/End: Complemental strand, 7174561 - 7174503
Alignment:
| Q |
264 |
ttgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatgga |
322 |
Q |
| |
|
|||||||| || ||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7174561 |
ttgtttctcttcatttggagaatgagtcttatggagagatattgcagcctgattatgga |
7174503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 308
Target Start/End: Complemental strand, 7160946 - 7160901
Alignment:
| Q |
263 |
attgtttcttttgatttggagacggagtcttttcgagagatattgc |
308 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
7160946 |
attgtttctcttgatttggagaaggagtcttatcgagagctattgc |
7160901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 9825696 - 9825635
Alignment:
| Q |
262 |
cattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggag |
323 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||| | || |||||| ||||||||||||||||||| |
|
|
| T |
9825696 |
cattgtttctcttgatttggggacagagtcctatcaagagattttgcagcctgattatggag |
9825635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 323
Target Start/End: Complemental strand, 9820016 - 9819955
Alignment:
| Q |
262 |
cattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggag |
323 |
Q |
| |
|
|||||||||| ||||||||| || ||||| | || |||||| ||||||||||||||||||| |
|
|
| T |
9820016 |
cattgtttctcttgatttggggagagagtcctatcaagagattttgcagcctgattatggag |
9819955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University