View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_high_31 (Length: 212)
Name: NF17743_high_31
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 41900456 - 41900515
Alignment:
| Q |
18 |
aaggggtagttttgcagatggtggaggaggagacttatagacatgcttaggttgtggtga |
77 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41900456 |
aaggggtagtgatgcagatggtggaggaggagacttatagacatacttaggttgtggtga |
41900515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 41900264 - 41900307
Alignment:
| Q |
18 |
aaggggtagttttgcagatggtggaggaggagacttatagacat |
61 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
41900264 |
aaggggtagtgatgcagatggtggaggaggagacttgtagacat |
41900307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University