View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_low_42 (Length: 248)
Name: NF17743_low_42
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 52584859 - 52584618
Alignment:
| Q |
1 |
tacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctctttttccataaaaatctctcttctttcactgttctagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584859 |
tacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctccttttccataaaaatctctcttctttcactgttctagagaga |
52584760 |
T |
 |
| Q |
101 |
tccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttattttttcaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52584759 |
tccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttatttattcaatca |
52584660 |
T |
 |
| Q |
201 |
ctttctctcagacnnnnnnngctagctacaattgatgatgtc |
242 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
52584659 |
ctttctctcagacaaaaaaagctagctacaattaatgatgtc |
52584618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University