View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_low_52 (Length: 220)
Name: NF17743_low_52
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 67 - 208
Target Start/End: Complemental strand, 35327162 - 35327021
Alignment:
| Q |
67 |
gcacatccaccactacacccacctgttcacacccctgttgttccaactcaccctccattacacccacctgctccagcacacccaccattgcatcctactc |
166 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35327162 |
gcacatccaccactacacccacccgttcacacccctgttgttccaactcaccctccattacacccacctgctccagcacacccaccattgcatcctactc |
35327063 |
T |
 |
| Q |
167 |
ccctccctagaagctttatagctgttcaaggtgttgtttatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35327062 |
ccctccctagaagctttatagctgttcaaggtgttgtttatg |
35327021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 208
Target Start/End: Complemental strand, 35335121 - 35335085
Alignment:
| Q |
172 |
cctagaagctttatagctgttcaaggtgttgtttatg |
208 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35335121 |
cctagaagcttaatagctgttcaaggtgttgtttatg |
35335085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University