View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_low_56 (Length: 210)
Name: NF17743_low_56
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 42 - 205
Target Start/End: Complemental strand, 3332625 - 3332462
Alignment:
| Q |
42 |
ccatcaattccacactttacagcagcagcaacaaaccacagatcaagatgaacaaagcggaagtagcagcggcggtggactcaacctcacaaaccgagaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332625 |
ccatcaattccacactttacagcagcagcaacaaaccacagatcaagatgaacaaagcggaagtagcagcggcggtggactcaacctcacaaaccgagaa |
3332526 |
T |
 |
| Q |
142 |
gaaaacagcaacaacaagttcagcacagattttagccccaagttagaatccggaggaggtggtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332525 |
gaaaacagcaacaacaagttcagcacagattttagccccaagttagaatccggaggaggtggtt |
3332462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University