View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17743_low_58 (Length: 204)
Name: NF17743_low_58
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17743_low_58 |
 | |
|
| [»] scaffold0175 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0175 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 162
Target Start/End: Original strand, 29790 - 29905
Alignment:
| Q |
47 |
ccatctttaatattgagacttgtcaatgactcaagactgtcaaagtatggataatcaagtgctgttttggcatatattctctcagcaggattgtacttga |
146 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
29790 |
ccatcattaatattgagacttgtcaatgactcaagactgtcaaagtatggatgatcaagtgctgttttggcatatattctctcagcatgattgtgcttga |
29889 |
T |
|
| Q |
147 |
gcattttctgcaggta |
162 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29890 |
gcattttctgcaggta |
29905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 77 - 167
Target Start/End: Original strand, 1221343 - 1221433
Alignment:
| Q |
77 |
tcaagactgtcaaagtatggataatcaagtgctgttttggcatatattctctcagcaggattgtacttgagcattttctgcaggtacataa |
167 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1221343 |
tcaagactgtcaaagtatggatgatcaagtgctgctttggcagatattctctcagcaggattgtacttgagcattttctgcaggtacataa |
1221433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University