View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17744_high_7 (Length: 252)
Name: NF17744_high_7
Description: NF17744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17744_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 51457893 - 51458065
Alignment:
| Q |
18 |
ctgcccgtgttcgcacacctgttgttccaactcacccacaattgcatcccactccttgccctagaagcttcaatgttgttcaaggtattgttcatgtcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51457893 |
ctgcccgtgttcgcacacctgttgttccaactcacccacaattgcatcccactccttgccctagaagcttcaatgttgttcaaggtattgttcatgtcaa |
51457992 |
T |
 |
| Q |
118 |
atcatgcgagtatgatggacttaacagtctcttgggtgctacaaagcttcttggttagtctctcatctctcac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51457993 |
atcatgcgagtatgatggacttaacagtctcttgggtgctacaaagcttcttggttagtctctcatctctcac |
51458065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 35327084 - 35327003
Alignment:
| Q |
50 |
cacccacaattgcatcccactccttgccctagaagcttcaatgttgttcaaggtattgttcatgtcaaatcatgcgagtatg |
131 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||||| | | |||||||||| ||||| |||||||||| ||| |||||| |
|
|
| T |
35327084 |
cacccaccattgcatcctactcccctccctagaagctttatagctgttcaaggtgttgtttatgtcaaatcttgcaagtatg |
35327003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University