View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17744_low_10 (Length: 273)
Name: NF17744_low_10
Description: NF17744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17744_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 258
Target Start/End: Original strand, 32682959 - 32683208
Alignment:
| Q |
9 |
atcatcacaacaaagaatcaatcacctacctagtcacatgcactattatgttcattttcatctaagtacctgcacgtcctagtaatttccatccaagtat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
32682959 |
atcatcacaacaaagaatcaatcacctacctagtcacatgcactattatgatcattttcatctaagtacctgaacgtcctagtaattttcatccaagtat |
32683058 |
T |
|
| Q |
109 |
tattgtcatttatttctgcaaacagaaatttacattcagaagtaaagtaacttgttgcttgctcatacatgcaaatgggacagatagatttgtctttctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683059 |
tattgtcatttatttctgcaaacagaaatttacattcagaagcaaagtaacttgttgcttgctcatacatgcaaatgggacagatagatttgtctttctc |
32683158 |
T |
|
| Q |
209 |
acatgactgtaacannnnnnnacatgtgcaagttttagatatgggagggc |
258 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32683159 |
acgtgactgtaacatttttttacatgtgcaagttttagatatgggagggc |
32683208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University