View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17744_low_9 (Length: 292)
Name: NF17744_low_9
Description: NF17744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17744_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 26833621 - 26833895
Alignment:
| Q |
1 |
tgcctaggcaaagaaacactgcaactctcagcaatggcacgatcaatggctctctgatttgtctccaacgaaactcgagttgtaaaccaagtccattcct |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26833621 |
tgcctaggcaaacaaacactgcaactctcagcaatggcacgatcaatggctctctgatttgtctccaaagaaactcgtgttgtaaaccaagtccattcct |
26833720 |
T |
 |
| Q |
101 |
tgctccttgaaaagcatacannnnnnnacttcaaatgnnnnnnngaataaatttaaccaactttacttaaagaaaaggagaaaaacttgtttttgtttcc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833721 |
tgctccttgaaaagcatacatttttttacttcaaatgtttttttgaataaatttaaccaactttacttaaagaaaaggagaaaaacttgtttttgtttcc |
26833820 |
T |
 |
| Q |
201 |
aggg-tcatgcagaaaagaaactgtggaagaggtagaaaaattaacaaaacgttgatatgcttgaagatctaagc |
274 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833821 |
aggggtcatgcagaaaagaaactgtgaaagaggtagaaaaattaacaaaacgttgatatgcttgaagatctaagc |
26833895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University