View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17745_low_9 (Length: 218)
Name: NF17745_low_9
Description: NF17745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17745_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 45658842 - 45659046
Alignment:
| Q |
1 |
aattttgagctatttcttcacaaacaccatttcatttgaactttactattcttgtctaaaacttaactctcattatcgagacaatggtaaggttctactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45658842 |
aattttgagctatttcttcacaaacaccatttcatttgaactttactattcttgtctaaaacttaactctcattatcgagacaatggtaaggttctactc |
45658941 |
T |
 |
| Q |
101 |
attcatctcactcatttttctaaccttagcttgtttctatatacatatagttgatgagtttcaaatctttgtaatacaggcagatcaagaggaaactgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45658942 |
attcatctcactcatttttctaaccttagcttgtttctatatacatatagttgatgagtttcaaatctttgtaatacaggcagatcaagaggaaactgaa |
45659041 |
T |
 |
| Q |
201 |
gaact |
205 |
Q |
| |
|
||||| |
|
|
| T |
45659042 |
gaact |
45659046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University