View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17746_low_13 (Length: 226)
Name: NF17746_low_13
Description: NF17746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17746_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 26920314 - 26920532
Alignment:
| Q |
1 |
ccaatgtaataaacagccattatcaatagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttgggtcaccaccagagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920314 |
ccaatgtaataaacagccattatcaatagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttgggtcaccaccagagc |
26920413 |
T |
 |
| Q |
101 |
tttcttcagctggaaaatttggttcatcttcatcactcatctgagaactttgttgttgctgtttgttcttggatgaagaaaatggaggaaacccatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920414 |
tttcttcagctggaaaatttggttcatcttcatcactcatctgagaactttgttgttgctgtttgttcttggatgaagaaaatggaggaaacccatgttt |
26920513 |
T |
 |
| Q |
201 |
cattgaatgatgatgatgt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26920514 |
cattgaatgatgatgatgt |
26920532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 41824970 - 41824834
Alignment:
| Q |
1 |
ccaatgtaataaacagccattatcaatagccttaccattgtatcagtccatttcattctttgccatggtgaaatcttcctttttgggtcaccaccagagc |
100 |
Q |
| |
|
||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| ||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
41824970 |
ccaatgtaataaacagccattattaagagtcttaccattgtatctgtccatttcattctatgccatggtgatccttttctttttgggtcaccaacagagg |
41824871 |
T |
 |
| Q |
101 |
tttcttcagctggaaaatttggttcatcttcatcact |
137 |
Q |
| |
|
|||| || ||| |||| |||||||||||||||||| |
|
|
| T |
41824870 |
tttcatctgctccaaaacatggttcatcttcatcact |
41824834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University