View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17746_low_14 (Length: 226)
Name: NF17746_low_14
Description: NF17746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17746_low_14 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 117 - 226
Target Start/End: Original strand, 6170687 - 6170796
Alignment:
| Q |
117 |
gtgaaatgaaggagactaagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170687 |
gtgaaatgaaggagactaagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttg |
6170786 |
T |
|
| Q |
217 |
tagacacaaa |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
6170787 |
tagacacaaa |
6170796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 51
Target Start/End: Original strand, 6170581 - 6170622
Alignment:
| Q |
10 |
taagttgttgggagttcagacacaagttgtgacagcttggtg |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170581 |
taagttgttgggagttcagacacaagttgtgacagcttggtg |
6170622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University