View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17747_low_5 (Length: 297)
Name: NF17747_low_5
Description: NF17747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17747_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 21 - 282
Target Start/End: Complemental strand, 12683617 - 12683356
Alignment:
| Q |
21 |
aatattcttcttcatctcgacgcggctgatcattctcagtctcagcttcctccatggtcacatccgccccggctgctggtggcacctgttgctgtggagg |
120 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683617 |
aatattcttcttcatctcgatgcggccgatcattctcagtctcagcttcctccatggtcacatccgccccggctgctggtggcacctgttgctgtggagg |
12683518 |
T |
|
| Q |
121 |
ccactgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctcgacgcagcagcagctgcaccctccaccttgttcttctgcctgtat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683517 |
ccactgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctcgacgcagcagcagctgcaccctccaccttgttcttctgcctgtat |
12683418 |
T |
|
| Q |
221 |
agagcatcaagttggtgaaagtaaggacatgtctttgaatcttctggcctcttcttgttgct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683417 |
agagcatcaagttggtgaaagtaaggacatgtctttgaatcttctggcctcttcttgttgct |
12683356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 44553171 - 44553205
Alignment:
| Q |
120 |
gccactgctgctccggctgaaccatcaacggtgcc |
154 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44553171 |
gccattgctgctccggctgaaccatcaacggtgcc |
44553205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University