View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17748_low_17 (Length: 246)
Name: NF17748_low_17
Description: NF17748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17748_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 11246448 - 11246685
Alignment:
| Q |
5 |
caaataaactcactggtaactactaatttacatgactt-gtttgtataatgtcaagttaagcttattttaacnnnnnnnnnnnnnnggaaatttgtaaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11246448 |
caaataaactcactggtaactactaatttacatgactttgtttgtataatgtcaagttaagcttattttaacaaaaaaagaaaaaaggaaatttgtaaaa |
11246547 |
T |
|
| Q |
104 |
gaccatggttcttcatgtttcttggttgagtttagctgctgtgaccatggatgcagctattccaccaggttcagcaatattcatcatttgttgtgttgat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11246548 |
gaccatggttcttcatgtttcttggttgagtttagctgctgtggccatggatgcagctattccaccaggttcagcaatattcatcatttgttgtgttgat |
11246647 |
T |
|
| Q |
204 |
gaattcttgtgcacctctgcatcaaacacaggttctgc |
241 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
11246648 |
gaattcttatgcacctctgcatcatacacagcttctgc |
11246685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University