View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17748_low_18 (Length: 231)
Name: NF17748_low_18
Description: NF17748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17748_low_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 231
Target Start/End: Complemental strand, 5982631 - 5982406
Alignment:
| Q |
6 |
aaagtcgaataacatgcccagtagcagtgtaacatgctttgtgggaaaacaaagaataatgctttgcataaagtttggccgaaacattaaatttaagtca |
105 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982631 |
aaagtcgaataacatgtccagtagcaatgtaacatgctttgtgggaaaacaaagaataatgctttgcataaagtttggccgaaacattaaatttaagtca |
5982532 |
T |
 |
| Q |
106 |
ttatatctaagataaatacaaaagtgttaaaaataaggtttaaattagatattagtctcatcaaatataccactttttacttttaaacaataaaaaatat |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982531 |
ttatatctaagataaatacaaaagtattaaaaataaggtttaaattagatattagtctcatcaaatataccactttttacttttaaacaataaaaaatat |
5982432 |
T |
 |
| Q |
206 |
atttttaatccttgcaaatatatcac |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5982431 |
atttttaatccttgcaaatatatcac |
5982406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 5978830 - 5978779
Alignment:
| Q |
12 |
gaataacatgcccagtagcagtgtaacatgctttgtgggaaaacaaagaata |
63 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
5978830 |
gaataacatgtccagtagcaatgtaacatgctttgtaggagaacaaagaata |
5978779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University