View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17749_low_10 (Length: 372)
Name: NF17749_low_10
Description: NF17749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17749_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 119 - 339
Target Start/End: Complemental strand, 10759464 - 10759241
Alignment:
| Q |
119 |
tagatcgaggtgttcttgactttttgtcgccactcaattgaaccc--atgagcctaatgtagttcctcttgattttgaaggaatttcatgttatattgca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10759464 |
tagatcgaggtgttcttgactttttgtcggcactcaattgagcccccatgagcgtaatgtagttcctcttgattttgaaggaatttcatgttatgttgca |
10759365 |
T |
 |
| Q |
217 |
taattataaaactgtattttc-nnnnnnnatgtaactacagtgttaagtttattatgaggcaaataaatgaggttgatcgtaaattatatgcaacatata |
315 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| ||||||| |||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
10759364 |
taattataaaactgtattttcttctttttatgtaactatagtgttatatttattacgaggcaaacaaatgaggttgatcgcaaattatatacaacatata |
10759265 |
T |
 |
| Q |
316 |
ttgatcaatgaaatgttatagaaa |
339 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10759264 |
ttgatcaatgaaatgttatagaaa |
10759241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University