View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1774_high_6 (Length: 258)
Name: NF1774_high_6
Description: NF1774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1774_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 25895757 - 25895518
Alignment:
| Q |
11 |
atgagtattaactggtggtggaggtgtggggggagcagaagtagtaaggggcagggatgcattgggtgaagttaagtgggtggcagaaaaggaaataggt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25895757 |
atgagtattaactggtggtggaggtgtggggggagcagaagtagtaaggggcagggatgcattgggtgaagttaagtgggtggcagaaaaggaaatatgt |
25895658 |
T |
 |
| Q |
111 |
gtagatgtgggttgatttattgaggaagttgtggaaggaagtggattt-tagaagaggacagatgatgggttgattgagagttgggagatgggaaattct |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25895657 |
gtagatgtgggttgatttatagaggaagttgtggaaggaagtggatttgtagaagaggacagatgatgggttgattgagagttgggagatgggaaattct |
25895558 |
T |
 |
| Q |
210 |
gatctgtaggggaagttataggaggggcaggtgatgatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25895557 |
gatctgtaggggaagttataggaggggcagctgatgatgt |
25895518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University