View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1774_low_9 (Length: 220)
Name: NF1774_low_9
Description: NF1774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1774_low_9 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 66 - 220
Target Start/End: Complemental strand, 7908216 - 7908062
Alignment:
| Q |
66 |
gatgcaactcgaaaggctttaatcgtttaatggcattacaaactagatacatgatttcagttaccgatatgcgaatgtgcttctccaataaataacgatc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
7908216 |
gatgcaactcgaaaggctttaatcgttttacggcattacaaactagatacatgatttcagttaccgatatccgaatgtgcttctccaaaaaataacgatc |
7908117 |
T |
|
| Q |
166 |
aaaaacaagtgatttccaccacttgcatacgcacctcaattgcagataatcgctt |
220 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908116 |
aagaacaagtgatttccaccacttgcatacgcacctcaattgcagataatcgctt |
7908062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 7332778 - 7332827
Alignment:
| Q |
162 |
gatcaaaaacaagtgatttccaccacttgcatacgcacctcaattgcaga |
211 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7332778 |
gatcaacaacgagtgatttccacaacttgcaaacgcacctcaattgcaga |
7332827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University