View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_high_10 (Length: 384)
Name: NF17750_high_10
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 6649400 - 6649767
Alignment:
| Q |
1 |
taggactaaccccaaatttgatgaagaactatgagatatcccataattatgattgacaatttgtaaaattaattcatgacagaaatagatcaagnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6649400 |
taggactaaccccaaatttgatgaagaattatgagatatcccataattatgcttgataatttgtaaaatcaattcatgacagaaatagatcaagaaaaaa |
6649499 |
T |
 |
| Q |
101 |
ngtaaatttactacaacaaaagcatgaaactagccaaacatgaaatttattatgctgattgataactgtgaaggtacaataatgtaacatgaaacaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649500 |
agtaaatttactacaacaaaagcatgaaattagccaaacatgaaatttattatgatgattgataactgtgaaggtacaataatgtaacatgaaacaaaag |
6649599 |
T |
 |
| Q |
201 |
ctcagatcaacatgatttgaatccacattcctttttctaatataactaagaactaatggatcttacaaccaatcatagtaggttcatgtatgctaaaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649600 |
ctcagatcaacatgatttgaatccacattcctttttctaatataactaagaactaatggatcttacaaccaatcatagtaggttcatgtatgctaaaaat |
6649699 |
T |
 |
| Q |
301 |
tgtgtctttttctaactcagaatttggttttagtctcgtagatctaactcaaccacacaaaatcacag |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649700 |
tgtgtctttttctaactcagaatttggttttagtctcgtagatctaactcaaccacacaaaatcacag |
6649767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University