View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_high_17 (Length: 268)
Name: NF17750_high_17
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 4776130 - 4776380
Alignment:
| Q |
1 |
aggagcttgcatttgttgtgctagtttattcaccgggaatgctatgtccgggcgtgtgattgaaaggtaatgtaaggcaccaagtatactgcgaaattcc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4776130 |
aggagcttgcatttgttatgctagtttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattcc |
4776229 |
T |
|
| Q |
101 |
ttactatcacagtatgtggagtcaggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcaatcacccatgtttgcacgaagga |
200 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
4776230 |
ttactgtcacagtatgtggagtcgggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcagtcgcccatgtttgctcgaagga |
4776329 |
T |
|
| Q |
201 |
gaatatctttgatgtaatgatgttgtgtaagaaataagccggtcttggttg |
251 |
Q |
| |
|
|||||||| | |||| ||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
4776330 |
gaatatctcttatgtgatgatcttgtgtaagaaataagccagtcctggttg |
4776380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University