View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17750_high_17 (Length: 268)

Name: NF17750_high_17
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17750_high_17
NF17750_high_17
[»] chr1 (1 HSPs)
chr1 (1-251)||(4776130-4776380)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 4776130 - 4776380
Alignment:
1 aggagcttgcatttgttgtgctagtttattcaccgggaatgctatgtccgggcgtgtgattgaaaggtaatgtaaggcaccaagtatactgcgaaattcc 100  Q
    ||||||||||||||||| ||||||||||||||| || ||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||||||||    
4776130 aggagcttgcatttgttatgctagtttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattcc 4776229  T
101 ttactatcacagtatgtggagtcaggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcaatcacccatgtttgcacgaagga 200  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||    
4776230 ttactgtcacagtatgtggagtcgggtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcagtcgcccatgtttgctcgaagga 4776329  T
201 gaatatctttgatgtaatgatgttgtgtaagaaataagccggtcttggttg 251  Q
    |||||||| | |||| ||||| |||||||||||||||||| ||| ||||||    
4776330 gaatatctcttatgtgatgatcttgtgtaagaaataagccagtcctggttg 4776380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University