View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_high_9 (Length: 385)
Name: NF17750_high_9
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 6 - 316
Target Start/End: Original strand, 3483523 - 3483839
Alignment:
| Q |
6 |
tgggtagataatactattgagttgaaaagattgagaaacaatgggtgagcctatgagggaa--------aacattgagttctaagagttgggtgtggaaa |
97 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3483523 |
tgggcagaaaatactattgagttgaaaagattgagaaacaatgggtgagcctatgagggaaaagtggaaaacattgagttctaagagttgggtgtggaaa |
3483622 |
T |
 |
| Q |
98 |
tttttagtgtcatgaactcatgatgaacaagcaaagcctaaatacgttgagaagtcacttagtattttcataactagtaagagtgtgattcaaggtaaca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483623 |
tttttagtgtcatgaactcatgatgaacaagcaaagcctaaatacgttgagaagtcacttagtattttcataactagtaagagtgtgattcaaggtaaca |
3483722 |
T |
 |
| Q |
198 |
ttcacttaagagatttggtgtgtatccacttaagagatttgtcatggcgtgtcttgaaattcactaggagcttctccaatgaaagtctatttaagtgagt |
297 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483723 |
ttcacttaagagatttg--gtgtatccacttaagagatttgtcctggcgtgtcttgaaattcactaggagcttctccaatgaaagtctatttaagtgagt |
3483820 |
T |
 |
| Q |
298 |
ttcattaaagatgagcatg |
316 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3483821 |
ttcattaaagatgagcatg |
3483839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 334 - 368
Target Start/End: Original strand, 3483856 - 3483890
Alignment:
| Q |
334 |
ctccattagagaaatttgacaaagtagcttaaata |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483856 |
ctccattagagaaatttgacaaagtagcttaaata |
3483890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University