View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_low_18 (Length: 286)
Name: NF17750_low_18
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 2 - 275
Target Start/End: Original strand, 6649151 - 6649423
Alignment:
| Q |
2 |
gcacgccagacacgcctttgattgtagtgtcggtactgtatcaagtcttaccatcaccatattgtaccgtgacaaatataactaaaagcttttccctttt |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6649151 |
gcacgccagacacgc-tttgattgtagtgtcggtactgcatcaagtcttaccatcaccatattataccatgacaaatataactaaaagcttttccctttt |
6649249 |
T |
 |
| Q |
102 |
cccgctatgtatggatcaatatcaccatcaccatattatttatcatgacaaataccatgttttcggaaaggtcgtctagatcaagatatagataggaact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6649250 |
cccgctatgtatggatcaatatcaccatcaccgtattatttatcatgacaaataccatgttttcggaaagatcgtctagatcaagatatagataggaact |
6649349 |
T |
 |
| Q |
202 |
ttctttgtacagtataaattgaagacaaatagcaagaccccaaattgatctaggactaaccccaaatttgatga |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6649350 |
ttctttgtacagtataaattgaagacaaatagcaagaccccaaattgatctaggactaaccccaaatttgatga |
6649423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University