View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_low_19 (Length: 275)
Name: NF17750_low_19
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 5955004 - 5955253
Alignment:
| Q |
11 |
caaaggtggcgttggtagtgctttttctaaatgttgattccagtttatttctatcactttttgttaatggttcatctgttggcattaaagggtcgaagaa |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955004 |
caaaggtggcattggtagtgctttttctaaatgttgattccagtttatttctatcactttttgttaatggttcatctgttggcattaaagggtcgaagaa |
5955103 |
T |
 |
| Q |
111 |
tctgagtgctagatttgcaacaagtccttttaaatctggtttaccaatctgaattcccagaagcaaatctagtatgaaaaggggaagctgattttctagc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955104 |
tctgagtgctagatttgcaacaagtcctttcaaatctggtttaccaatctgaattcccagaagcaaatctagtatgaaaaggggaagctgattttctagc |
5955203 |
T |
 |
| Q |
211 |
atgatcatatctctttgaatcgaatgcatcgatccgcgcattgcaaaaac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955204 |
atgatcatatctctttgaatcgaatgcatcgatccgcgcattgcaaaaac |
5955253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University