View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_low_2 (Length: 558)
Name: NF17750_low_2
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-150; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 130 - 479
Target Start/End: Original strand, 32785644 - 32785993
Alignment:
| Q |
130 |
aagaagctaaattagtccacataaattaacacaagggagaatcgagtttgaactttaaggaggaacactcaaaaaatctcaagccaacaccaccagacca |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32785644 |
aagaagctaaattaatccacataaattaacacaagggagaatcgagtttgaactttaaggaggaacactcaaaaaatctcaagccaacaccaccagacca |
32785743 |
T |
|
| Q |
230 |
acctaagcggcctcactcaccgcaatctccaccagctgcaacatgtcacttaaaaagcnnnnnnnnnnnnnnnnnnnngaggaagtcacttagcaagctt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32785744 |
acctaagcggcctcactcaccgcaatctccaccagctgcaacatgtcacttaaaaagctttattttatttttatttttgaggaagtcacttagcaagctt |
32785843 |
T |
|
| Q |
330 |
aacaacttgataaaatgttgtttgaactgagtttagttggttagaagttagttacaacccgtaactagttactcgagttgcttagtttacatcgtatttc |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32785844 |
aacaacttgataaaatgttgtttgaactgagtttagttggttagaagttagttacaacccgtaactagttactcgagctgcttagtttacatcacatttc |
32785943 |
T |
|
| Q |
430 |
agatcactgaatctatgaggtttctactactcttaattctctctgctgca |
479 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32785944 |
aaatcactgaatctatgaggtttctactactcttaattctctctgctgca |
32785993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 32785529 - 32785602
Alignment:
| Q |
16 |
cttttgagataaggaaaaattactctttaaaacacctcacacaccaacaagtagttacacttacaactaggtgg |
89 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32785529 |
cttttgagataaggaaaaagtactctttaaaacacctcacacaccaacaagtagttacacttacaactaggtgg |
32785602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 130 - 174
Target Start/End: Complemental strand, 22035512 - 22035468
Alignment:
| Q |
130 |
aagaagctaaattagtccacataaattaacacaagggagaatcga |
174 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| | ||||||||| |
|
|
| T |
22035512 |
aagaagctaaattagtccacttaaattgacacaggagagaatcga |
22035468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University