View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17750_low_28 (Length: 223)
Name: NF17750_low_28
Description: NF17750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17750_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 13976490 - 13976304
Alignment:
| Q |
17 |
taggcaaatgcatctgagatatatatttgttatgatagcacaaaacgatataagtaannnnnnnnn-atctgatagaaattcatttatgaaaaataaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13976490 |
taggcaaatgcatctgagatatatatttgttatgatagcacaaaacgatataagtaatattttttttatctgatagaaattcatttatgaaaaataaatt |
13976391 |
T |
 |
| Q |
116 |
gaggagacataaacctaatccaattgaagagaaaaagacaaacnnnnnnnnnnnncttttcatattatgtaagaatttcattcctatatc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13976390 |
gaggagacataaacctaatccaattgaag-gaaaaagacaaac--aaaaaaaaagcttttcatattatgtaagaatttcattcctatatc |
13976304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University