View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17751_high_14 (Length: 228)
Name: NF17751_high_14
Description: NF17751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17751_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 215
Target Start/End: Complemental strand, 8056908 - 8056716
Alignment:
| Q |
21 |
atacgtctaatatgagaaatgttggtgcttactaaattacaataattattacttacgtaagatccttcatgtaagagatgattttattattatttttccc |
120 |
Q |
| |
|
||||| ||||| |||||| |||| ||| |||| |||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056908 |
atacggctaatctgagaagtgtttgtgtttacgaaattacaataattattagatacttaa-atccttcatgtaagagatgattttattattatttttccc |
8056810 |
T |
 |
| Q |
121 |
ataactttagtttgacacttggtgttgtgttactagctgacaatttgggagagacaatgattccatatctgaaagtagtttcctacaatgcttct |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056809 |
ataactttagtt-gacacttggtgttgtgttactagctgacaatttgggagagacaatgattccatatctgaaagtagtttcctacaatgcttct |
8056716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University