View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17751_low_19 (Length: 214)
Name: NF17751_low_19
Description: NF17751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17751_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 25178269 - 25178090
Alignment:
| Q |
17 |
taggtcaccctatttccattccattctctcttgaagagga-ggatgcaaatatttctttgttcatgnnnnnnnnctttgtttacaaaatttcttttatcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25178269 |
taggtcaccctatttccattccattctctcttgaagaggaaggatgcaaatatttttttgttcatgttttttt-ctttgtttacaaaatttcttttatcg |
25178171 |
T |
 |
| Q |
116 |
ttagttttgatggaaaaaagaatatcattaagttcttaatctaggtaaaacaaacatgacatttctctacataattaaaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25178170 |
ttagttttgatggaaaaaagaatatcattaagttcttaatctaggtaaaacaaacatgacatttctctacataattaaaaa |
25178090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University